View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_high_52 (Length: 204)
Name: NF15916_high_52
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 25 - 186
Target Start/End: Original strand, 46144511 - 46144669
Alignment:
| Q |
25 |
cctcttcacctaatttaatccttctttgttttttctgcaacaaaaactcttcacccaatgccactaacttcattttcaaacactcactcaaatcatcatt |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46144511 |
cctcttcacctaatttaatcattctttgttttttctgcaacaaaaactcttcacccaatgccactaacttcattttcaaacactcactcaaatcatcatt |
46144610 |
T |
 |
| Q |
125 |
atcactgctagctgctgctgctgctttctctctcttcctttccctttcttgtcctttgctac |
186 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46144611 |
atcactgcta---gttgcttctgctttctctctcttcctttccctttcttgtcctttgctac |
46144669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University