View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15916_high_53 (Length: 202)

Name: NF15916_high_53
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15916_high_53
NF15916_high_53
[»] chr3 (1 HSPs)
chr3 (15-160)||(9274029-9274174)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 160
Target Start/End: Original strand, 9274029 - 9274174
Alignment:
15 aaaatcttctcttgatgtacatatcttcctttaacaatagtcaatatctttattttgagaattatgtttagaacacacttctctcagtaagttgaaattt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9274029 aaaatcttctcttgatgtacatatcttcctttaacaatagtcaatatctttattttgagaattatgtttagaacacacttctctcagtaagttgaaattt 9274128  T
115 aaaacctatatattgagagagtttgttatatgagaagtaaatgata 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
9274129 aaaacctatatattgagagagtttgttatatgagaagtaaatgata 9274174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University