View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_high_53 (Length: 202)
Name: NF15916_high_53
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 160
Target Start/End: Original strand, 9274029 - 9274174
Alignment:
| Q |
15 |
aaaatcttctcttgatgtacatatcttcctttaacaatagtcaatatctttattttgagaattatgtttagaacacacttctctcagtaagttgaaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9274029 |
aaaatcttctcttgatgtacatatcttcctttaacaatagtcaatatctttattttgagaattatgtttagaacacacttctctcagtaagttgaaattt |
9274128 |
T |
 |
| Q |
115 |
aaaacctatatattgagagagtttgttatatgagaagtaaatgata |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9274129 |
aaaacctatatattgagagagtttgttatatgagaagtaaatgata |
9274174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University