View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_low_37 (Length: 378)
Name: NF15916_low_37
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 23876618 - 23876988
Alignment:
| Q |
1 |
tcttgttttagagttatgatatttggttggcggtgcttcatttgtctattgctaatatgtttttatttgtatgatggtcaaaatttatatgcct-gataa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
23876618 |
tcttgttttagagttatgatatttggttggcggtgcttcatttgtctactgctaatctgtttttatttgtatgatggtcaaa-tttatatgccttgataa |
23876716 |
T |
 |
| Q |
100 |
atttctcaaactctcttattttgtatcaaaatatgcggctatgcttcttttattgtgtttcataggttactgaacataatctatatgctttttgaattat |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||| |||| |
|
|
| T |
23876717 |
atttctcaaattctcttattttgtatcaaaatatgcggctatgcttcttttattgtgtttcatagattactgaacataatgtatatgc----tgagttat |
23876812 |
T |
 |
| Q |
200 |
tcctttgttgtagatatttcatgtttctgaattatacttttactccttttttctatgaataatattatttttgttttgaagataatgttttcaaaagtgt |
299 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
23876813 |
tccattgttgtagatatttcatgtttctgaattatacttttactccttttttcttggaataatattattttt-atttgaagatattgttttcaaaagtgt |
23876911 |
T |
 |
| Q |
300 |
ggatatagtggcctagttttccacaactcattgcttcacattgggcttactcatgttgttttgattggtctgtgttg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||| |||||| |
|
|
| T |
23876912 |
ggatatagtggcctagttttccacaactcattgcttcacattggacttacacatgttgttttgcttggtcagtgttg |
23876988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University