View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_low_38 (Length: 359)
Name: NF15916_low_38
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 14 - 344
Target Start/End: Original strand, 778234 - 778563
Alignment:
| Q |
14 |
aatattcaatatttatttaccattttgaatgtcacatgtcagaatcagacaacatnnnnnnnnncaacctttttctgtgtctttcacttcatgcaacaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
778234 |
aatattcaatatttatttaccattttgattgtcacatgtcagaatcagacaacataaaaaaaa-caacctttttctgtgtctttcacttcatgcaacaaa |
778332 |
T |
|
| Q |
114 |
caactatgtctccttattttctctcatcaaacctcaacatgcacaatctctatgtctcaccttcttcttcaaccttacatctttcaaaccacataaccaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
778333 |
caactatgtctccttattttctctcatcaaacctcaacatgcacaatctctatgtctcaccttcttcttcaaccttacatctttcaaaccacataaccaa |
778432 |
T |
|
| Q |
214 |
accaaaatttcacccttttcaaaattctcattctcacaatttttcttcttcaccacttagactcaccattgatggatttgcatgtccatcttcttctttc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
778433 |
accaaaatttcacccttttcaaaattctcattctcacaatttttcttcttcaccacttagactcaccattgatggatttgcatgtccatcttcttctttc |
778532 |
T |
|
| Q |
314 |
ttccaaactgttggaaaatcttcacctttct |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
778533 |
ttccaaactgttggaaaatcttcacctttct |
778563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University