View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_low_43 (Length: 298)
Name: NF15916_low_43
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 182
Target Start/End: Complemental strand, 55386706 - 55386546
Alignment:
| Q |
14 |
ataatactaatgttcagggacaatgacttattgactttaatattgcaaaatctcattcgacatggaaaaatggtctcctgccgtgcgaggcatgccatgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55386706 |
ataatactaatgttcagggacaatgactt--------taatattgcaaaatctcattcgacatggaaaaatggtctcctgccgtgcgaggcatgccatgc |
55386615 |
T |
 |
| Q |
114 |
acatatcctattcccactaacaatttcaaaatttcaaagttgtatcatagttcccattatgctactttg |
182 |
Q |
| |
|
||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55386614 |
acacatcctattcccaccaacaatttcaaaatttcaaagttgtatgatagttcccattatgctactttg |
55386546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University