View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15916_low_56 (Length: 221)
Name: NF15916_low_56
Description: NF15916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15916_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 17107099 - 17107282
Alignment:
| Q |
20 |
ttctggtgaatttaatgctcttcaaataatgagggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107099 |
ttctggtgaatttaatgctcttcaaataatgagggacactcttgcagaaatcagtggttcataccttaatgatactaatttcactctggttcaacgtaag |
17107198 |
T |
 |
| Q |
120 |
gtagcaaatgaactgaaagggaagaagttttttattgttttggacaatatgtggaatgacgacgaagtggaattggaagatttg |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
17107199 |
gtagcaaatgaactgaatgggaagaagttttttattgttttggacaatatgtggaatgacaacgaagtggaattgaaagatttg |
17107282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University