View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15917_high_12 (Length: 232)
Name: NF15917_high_12
Description: NF15917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15917_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 43061124 - 43061320
Alignment:
| Q |
20 |
ctttggcatgcaagtgtttcggttcaatttacatattttattgtcagttttacctgactgtttgtatttgtctcctgctgttttctcagtataggtggct |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43061124 |
ctttggcatgcaagtgtttcagttcaatttacatattttattgtcagttttacctgactgtttgtatttgtctcctgctggtttctcagtataggtggct |
43061223 |
T |
|
| Q |
120 |
acaatttaatttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaacaaatagttgaaacttgctgatatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43061224 |
acaatttaatttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaacaaatagttgaaacttgctgatatt |
43061320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 1380596 - 1380662
Alignment:
| Q |
129 |
tttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaacactttcaaacaaa |
195 |
Q |
| |
|
|||| |||||||| |||||| ||||| ||| | ||||||||| ||||||||||| | |||||||||| |
|
|
| T |
1380596 |
tttgtctctttagcgtagttggttttagtttgatttcaagatagttaaataaacgccttcaaacaaa |
1380662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 181
Target Start/End: Original strand, 40910936 - 40910989
Alignment:
| Q |
128 |
atttggctctttagtgtagtttgttttggttcgttttcaagatggttaaataaa |
181 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| ||||| |||| |||||||||| |
|
|
| T |
40910936 |
atttgtctctttagtgtagttggttttggtttgttttagagatagttaaataaa |
40910989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University