View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15917_low_13 (Length: 238)
Name: NF15917_low_13
Description: NF15917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15917_low_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 41904730 - 41904951
Alignment:
| Q |
17 |
agaagtgtcacatatgatataccgtgtacgatgtttgaaaataaaacaatgattagtgttgctctctgtaagtagtagcgcttggtattatgtgtcctca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
41904730 |
agaagtgtcacatatgatataccgtgtacgatgtttgaaaataaaacaatgattagtgttgctctctctaagtagtagcgcttggtatcatgtgtcctca |
41904829 |
T |
 |
| Q |
117 |
cgactgagacgatgacatgattggtgtcgatcggcnnnnnnnntaaaactaaatactagtgttttaaaactgaacgtatatatgttttatgttgtttttg |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41904830 |
cgactgagacggtgacatgattggtgtcgatcggcaaaaaaaataaaactaaatattagtgttttaaaactgaacgcatatatgttttatgttgtttttg |
41904929 |
T |
 |
| Q |
217 |
atgaattaacatcaatcaagtc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41904930 |
atgaattaacatcaatcaagtc |
41904951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University