View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15918_high_13 (Length: 204)
Name: NF15918_high_13
Description: NF15918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15918_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 33840649 - 33840528
Alignment:
| Q |
68 |
gctgttgttaaaaatggcattcataaccgccacagtatgcaaccaccttaaaaactgtcgtcggttccttctgccatcaattgttacaagtgttaacggt |
167 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33840649 |
gctgttgtttaaaattgcattcataaccgccacagtatgcaaccaccttaaaaactgtcgtcggtttcttctgccatcaattgttacaagtgttaacggt |
33840550 |
T |
 |
| Q |
168 |
agtgaaatgcagtgcacaatac |
189 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
33840549 |
agtgaaatgtagtgcacaatac |
33840528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University