View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15919_low_17 (Length: 270)
Name: NF15919_low_17
Description: NF15919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15919_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 51 - 216
Target Start/End: Original strand, 32289675 - 32289840
Alignment:
| Q |
51 |
atagatagttcatgtttcccgaggtttgaatcccgtttgcgcctcactctcccccatcgtttcccgcttcaccaccgattcataatttctcaaactacaa |
150 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32289675 |
atagatagttcatgtttcccgaggcttgaatcccttttgcgcctcactctcccccatcgtttcccgcttcaccaccgattcataatttctcaaactacaa |
32289774 |
T |
|
| Q |
151 |
tctgaaattcacacttttccgatactgaatctcactcaatattcctttcccttcttcaattaacac |
216 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32289775 |
tttgaacttcacacttttccgatactgaatctcactcaatattcctttcccttcttcaattaacac |
32289840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 212 - 263
Target Start/End: Complemental strand, 32291876 - 32291825
Alignment:
| Q |
212 |
aacaccttccccatgtctcctgctagactcttggaccaataaactgatgatg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291876 |
aacaccttccccatgtctcctgctagactcttggaccaataaactgatgatg |
32291825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 263
Target Start/End: Original strand, 42492851 - 42492887
Alignment:
| Q |
227 |
tctcctgctagactcttggaccaataaactgatgatg |
263 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
42492851 |
tctcctgctagactgttggaccaataaactaatgatg |
42492887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University