View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591_high_10 (Length: 244)
Name: NF1591_high_10
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 34423633 - 34423844
Alignment:
| Q |
1 |
cccattgcaggtctattctgttgtacgatgagaaccttctgtggctaatgtatagtagtagcagtttatttgttaaagtgtaaacatggtaccctgcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34423633 |
cccattgcaggtctattctgttgtatgatgagaaccttctgtggctaatgtatagtagtagcagtttatttgttaaagtgtaaacatggtaccctgcaat |
34423732 |
T |
 |
| Q |
101 |
ttgatt-aagcacctagaatcttttatcaatcaacaccctaggtgctggctgaggtttgatttgtttagtgtttacttgtctcatttagtacaaaagtac |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34423733 |
ttgattaaagcacctagaatcttttatcaatcaacaccctaggtgctggctgaggtttgatttgtttaatgtttacttgtctcatttagtacaaaagtac |
34423832 |
T |
 |
| Q |
200 |
caagtctaggac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
34423833 |
taagtctaggac |
34423844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University