View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591_high_13 (Length: 204)
Name: NF1591_high_13
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591_high_13 |
 |  |
|
| [»] scaffold0045 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 33175 - 33347
Alignment:
| Q |
18 |
ataagaatggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggtacattgaattggttgccgatcttaagaaagttac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33175 |
ataagaatggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggtacattgaattggttgccgatcttaagaaagttac |
33274 |
T |
 |
| Q |
118 |
agaattttgtctcaatttttcttttgcaagaaaataaatatttgtctctttttctgtcattctaaaccttcat |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
33275 |
agaattttgtctctatttttcttttgcaagaaaataaataattatctctttttctgtcattataaaccttcat |
33347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 40642 - 40707
Alignment:
| Q |
18 |
ataagaatggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggt |
83 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
40642 |
ataagaatggccaatgtttcgtcttttgttttcagaaaagttgtaaatgaagtcgattataaaggt |
40707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 25931 - 26000
Alignment:
| Q |
18 |
ataagaatggccaatgttgcggcttttgttttcaggaaagctgcaaatgaagtcgattataaaggtacat |
87 |
Q |
| |
|
||||||||||||||| |||| |||| || |||||| |||| || | |||||| |||||||||||||||| |
|
|
| T |
25931 |
ataagaatggccaatattgcagcttgtgctttcagaaaagttgacactgaagttgattataaaggtacat |
26000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University