View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591_high_9 (Length: 249)
Name: NF1591_high_9
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 34423417 - 34423653
Alignment:
| Q |
13 |
aatatgaaatgtaattttaagtgatgtaaattttggagctacatgggaacctataacctgtagttctcatttctgcattaaaaactattcatgcattcaa |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34423417 |
aatatgaaatgtaattttaagtggtgtaaattttggagctacatgggaacctataacctgtagttctcatttctgcattaaaaactattcatgcattcaa |
34423516 |
T |
 |
| Q |
113 |
atgagctctcagaacgttgctttgcttttgaatgatgatatcaacgactgttaatgatgaattgcttaataaatagtgctacaaagcttatatggcagag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34423517 |
atgagctctcagaacgttgctttgcttttgaatgatgatatcaacgactgttaatgatgaattgcttaatgaatagtgctacaaagcttatatggcagag |
34423616 |
T |
 |
| Q |
213 |
tctagggaaggttgaacccattgcaggtctattctgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34423617 |
tctagggaaggttgaacccattgcaggtctattctgt |
34423653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University