View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591_low_12 (Length: 238)
Name: NF1591_low_12
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 26106686 - 26106462
Alignment:
| Q |
1 |
aatttcatttattaataattttagtttaatcctttggttatgtcctttgactcttatcaccatgcaacataatctcatttttattattttaaaatataat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26106686 |
aatttcatttattaataattttagtttaatcatttggttatgtcctttgactcttatcaccatgcaacataatctcatttttattattttaaaatataat |
26106587 |
T |
|
| Q |
101 |
taagtcctttatatatataatttggacgtgagatagagtcacggcggggaaaattgataaaca--nnnnnnnncttaaaaaagataaaattgatgaactt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
26106586 |
taagtcctttatatatataatttggacgtgagatagagtcacggcggggaaaattgataaacattttttttttcttaaaaaagataaaattgatgaaatt |
26106487 |
T |
|
| Q |
199 |
ttttaatagtaaaccaaactgaaac |
223 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
26106486 |
ttttaatagtaaatcaaactgaaac |
26106462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University