View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1591_low_9 (Length: 250)
Name: NF1591_low_9
Description: NF1591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1591_low_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 5 - 250
Target Start/End: Complemental strand, 26107026 - 26106781
Alignment:
| Q |
5 |
gagtgagatgaaaacattaaaattgtaaacttagtccaaaaaagaaattgtaattgacattgtatctactatttgctggcatctgtgtattgtaagctat |
104 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26107026 |
gagtgtgatgacaacattaaaattgtaaacttagtccaaaaaagaaattgtaattgacattgtatctattatttgctggcatctgtgtattgtaagctat |
26106927 |
T |
|
| Q |
105 |
tactttgtgatttcttgtgcaatattgttcacaaagtactttgtaatttctttatcaaaatctgtttgatgacatgaaacattcttttcaacttttgcca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26106926 |
tactttgtgatttcttgtgcaatattgttcacaaagtactttgtaatttctttatcaaaatctgtcagatgacatgaaacattcttttcaacttttgcca |
26106827 |
T |
|
| Q |
205 |
tttcatttcatataatcatactatggttttaaccctccaattcctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26106826 |
tttcatttcatataatcatactatggttttaaccctccaattcctc |
26106781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University