View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1592-INSERTION-5 (Length: 280)
Name: NF1592-INSERTION-5
Description: NF1592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1592-INSERTION-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 60 - 275
Target Start/End: Complemental strand, 42125559 - 42125341
Alignment:
| Q |
60 |
cactacttcatgtctcgtgtaactaaaattacttctgtgagcattttgattatgtgttgcttactttgatctttatcaattgctctcatagagcaactaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125559 |
cactacttcatgtctcgtgtaactaaaattacttctgtgagcattttgattatgtgatgctcactttgatctttatcaattgctctcatagagcaactaa |
42125460 |
T |
|
| Q |
160 |
ttcaaacagataacaaagagcacattctgaccagaccaagctagaaaggcttcacggcattgctttcatgaacacgtac---cccaagaaattatggatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42125459 |
ttcaaacagataacaaagagcacattctgaccagaccaagctagaaaggcttcacggcattgctttcatgaacacgtacgtacccaagaaattatggatg |
42125360 |
T |
|
| Q |
257 |
ataattagaatgggtagca |
275 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42125359 |
ataattagaatgggtagca |
42125341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Complemental strand, 42125587 - 42125554
Alignment:
| Q |
7 |
ataatcgagagagaaattatttatatgtcactac |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42125587 |
ataatcgagagagaaattatttatatgtcactac |
42125554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University