View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15920_low_5 (Length: 231)
Name: NF15920_low_5
Description: NF15920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15920_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 86 - 212
Target Start/End: Complemental strand, 27832877 - 27832751
Alignment:
| Q |
86 |
gaagaagcctcggattcaagaattattgtatcgatcaaagaataatctctcagatggtacggacaatattcatacatcacaggcaaataattaataatga |
185 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832877 |
gaagaagcctcagattcaagaattattgtatcgatcaaagaataatctctcagatggtacggacaatattcatacatcacaggcaaataattaataatga |
27832778 |
T |
|
| Q |
186 |
tatgataaaaatataggtcgttaccag |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27832777 |
tatgataaaaatataggtcgttaccag |
27832751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 27832926 - 27832883
Alignment:
| Q |
17 |
cagagactctaaattgttgcctattctctcaatcaaaacagaaa |
60 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
27832926 |
cagagactctaaattgttgcctattatttcaatcaaaacagaaa |
27832883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University