View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15922_low_15 (Length: 213)
Name: NF15922_low_15
Description: NF15922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15922_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 39688792 - 39688611
Alignment:
| Q |
14 |
cataggtgatgaaggaaaggagtgtgcttttctattaccattatttaatatagttcattgtcttgactttatgaatgtcaacctatatttagtgacatct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39688792 |
cataggtgatgaaggaaaggagtgtgcttttctattaccattatttaatatagttcattgtcttgactttacgaatgtcaacctatatttagtgacatct |
39688693 |
T |
 |
| Q |
114 |
taatnnnnnnnctttagtgacatattgctttattggaatttccctctcttttatttaacgtggattagactttatgttacta |
195 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
39688692 |
taataaaataactttagtgacatattgctttattggactttccctctcttttatttaacgtgtattagactttctgttacta |
39688611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University