View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15922_low_16 (Length: 205)
Name: NF15922_low_16
Description: NF15922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15922_low_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 34142199 - 34142403
Alignment:
| Q |
1 |
cccaattctcccgttaaatattttaggacgtccccagaacactaggctcctgtgcagccttatctctgctattgaagaagctgttttcaggattcaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142199 |
cccaattctcccgttaaatattttaggacgtccccagaacactaggctcctatgcagccttatctctgctattgaagaagctgttttcaggattcaaatt |
34142298 |
T |
|
| Q |
101 |
tgtgacctatgtaaatagataagacatgaattgagtttataaacggcgacacttctcacttaatataaaaatgtattaaccttcacgtcacaaggcaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
34142299 |
tgtgacctatgtaaatagataagacatgaattgagtttataaacggcgacacttctcacttaatataaaaatttaataaccttcacgtcgcaaggcaacg |
34142398 |
T |
|
| Q |
201 |
aacga |
205 |
Q |
| |
|
||||| |
|
|
| T |
34142399 |
aacga |
34142403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University