View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15923_high_12 (Length: 282)
Name: NF15923_high_12
Description: NF15923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15923_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 275
Target Start/End: Complemental strand, 13023497 - 13023227
Alignment:
| Q |
2 |
cgccttggattttgttcttgtcatcgaataggagattgggtcggaggtggtgtgaagtaaccattgtggtggtttacggtgattatagttgatcatttca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
13023497 |
cgccttggattttgttcttgtcatcgaataggagattgggtcggaggtggtgtgaagtaacc---gtggtggtttacggtggttatagttgattatttca |
13023401 |
T |
 |
| Q |
102 |
caatatagagggtgtatctgcaaagatatttcgacactcaagtcagtgaggtttcaatgaactttgagaaacaatgaattggtttatcatcgtaacgatt |
201 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
13023400 |
caatatagatggtgtatttgtaaagatatttcgacactcaagtcagtgaggtttcaatgaactttgagaagcaaagaattggtttatcatcgtaacgatt |
13023301 |
T |
 |
| Q |
202 |
gctttccctataaatatgagaaacaatgaattccacttgaaaacataattgcaattagaaactcaatgcctttg |
275 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13023300 |
gttttccctataaatataagaaacaatgaattccacttgaaaacataattgcaattagaaactcaatgcctttg |
13023227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University