View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15923_low_10 (Length: 362)
Name: NF15923_low_10
Description: NF15923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15923_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 348
Target Start/End: Original strand, 4242155 - 4242485
Alignment:
| Q |
18 |
tgatacgtaaacattcatttaacgcacaaaccacaaaagaaaatgtggaaatgaattgttgatataattccaaaacctgttttatgtaatgttagccatt |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4242155 |
tgatatgtaaacattcatttaacgcacaaaccacaaaagaaaatgtggaaatgaattgttgatataattccaaaacctgttttatgtaatgttagccatt |
4242254 |
T |
 |
| Q |
118 |
cataatctgtgtgctttttactttctcagcacacatgtatctttttgtgcatcatacttatgcatggtcgttatttttgccacaacactagtcaatttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4242255 |
cataatctgtgtgctttttactttctcagcacacatgtatctttttgtgcatcatacttatgcatggtcgttatttttgccacatcactagtcaatttga |
4242354 |
T |
 |
| Q |
218 |
aatattcaacgcaatgattcttggtcctcataatatccatcaaccataccnnnnnnnnnnnnnnngaaatttgtaactttcatgaatgtaacattttgaa |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
4242355 |
gatattcaacacaatgattcttggtcctcataatatccatcaaccataccttttttttttcttctgaaattcgtaactttcatgaatgtaacattttgaa |
4242454 |
T |
 |
| Q |
318 |
ttccttattgcactatttccaccctggtatt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4242455 |
ttccttattgcactatttccaccctggtatt |
4242485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University