View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15925_high_7 (Length: 380)
Name: NF15925_high_7
Description: NF15925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15925_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 41866158 - 41866319
Alignment:
| Q |
17 |
gtagcaatagagagataaaaagatacacaaattgatttcacattggatagaatggaaaagagtaaaattcaaacgtacaaggatggtattgcaagcagtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41866158 |
gtagcaatagagagataaaaagatacacaaactgttttcacattggatagaatggaaaagagtaaaattcaaacgtacagggatggtattgcaagcagtt |
41866257 |
T |
 |
| Q |
117 |
atggtattttgttctgcatcaacaaagaggcttcaataaagaatagagataaatcaacaatc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41866258 |
atggtattttgttctgcatcaacaaagaggcttcaataaagaatagagataaatcaacaatc |
41866319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University