View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15925_low_10 (Length: 333)
Name: NF15925_low_10
Description: NF15925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15925_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 142 - 317
Target Start/End: Original strand, 27779797 - 27779969
Alignment:
| Q |
142 |
attgtttttaccaaagagagggnnnnnnnnttgtcacaaaagttgtttaaaattgacaaatatcattcctcatttatattctcatacgtgtagctagtcg |
241 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27779797 |
attgtttttaccaaagagagggaaatttttttgtcacaaaagttgtttaaaattgacaaatatcattcctcatttatattctcatacgtgtagctagtcg |
27779896 |
T |
 |
| Q |
242 |
acttctcaagaatgtatggttttcgattgcaattgtttaactttcacaacttacaagatcctacattcccttttct |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27779897 |
acttctcaagaaagtatggttttcgattgcaattgttttactttcacaacttacaaga---tacattcccttttct |
27779969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 27779654 - 27779745
Alignment:
| Q |
1 |
acttccaaaactgtcctcagacctttcttcaattttcttttctttcttcaatt--tatgaaaaatgatattcatacaactatttttggacaa |
90 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
27779654 |
actttcaaaactgccctctgacctttcttcaattttcttttctttcttcaatttatatgagaaatgatattcgtacaatcatttttggacaa |
27779745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University