View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15925_low_14 (Length: 242)
Name: NF15925_low_14
Description: NF15925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15925_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 5470202 - 5470017
Alignment:
| Q |
17 |
gatttgagttttattccaagtagtggaaattctaataattatggttttattaatggaattgaagtcttatccatgcctgatgatctatattatacaccac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
5470202 |
gatttgagttttattccaagtagtggaaattctaataactatggttttgttaatggaattgaagtcttatccatgcctgattatctctattatacaccac |
5470103 |
T |
 |
| Q |
117 |
ctgatgatcctggattttcacttgtggggtccaccatcataccagcatatactattacatccaaggtcgcactagagacaggtaaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
5470102 |
ctgatgatcctggattttcacttgtggggtccaccgtcataccagcatatactattccatccaacgttgcactagagacaggtaaa |
5470017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 49 - 150
Target Start/End: Original strand, 5476750 - 5476845
Alignment:
| Q |
49 |
taataattatggttttattaatggaattgaagtcttatccatgcctgatgatctatattatacaccacctgatgatcctggattttcacttgtggggtcc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| || |
|
|
| T |
5476750 |
taataattatggttttattaatggaattgaagtcttatccatgcctgatgatctatattatacacc------tgatcctgaattttcacttgtgggggcc |
5476843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University