View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15925_low_3 (Length: 650)
Name: NF15925_low_3
Description: NF15925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15925_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 4e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 165 - 285
Target Start/End: Original strand, 24942002 - 24942119
Alignment:
| Q |
165 |
aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt |
264 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24942002 |
aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt |
24942098 |
T |
|
| Q |
265 |
gttctattagttacatgttgc |
285 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24942099 |
gttctattagttacatgttgc |
24942119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 450 - 483
Target Start/End: Complemental strand, 20515628 - 20515595
Alignment:
| Q |
450 |
catctctggaagcatcttcaatcattcaacttct |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20515628 |
catctctggaagcatcttcaatcattcaacttct |
20515595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 415
Target Start/End: Complemental strand, 11299456 - 11299382
Alignment:
| Q |
341 |
cattgacagaataagcaccttaccagactctatactctgccacatcctttcattcctctcaaccaaaacctccat |
415 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||||||| | || |||||| ||||||||||| |||| |
|
|
| T |
11299456 |
cattgacagactaagcaatctaccagactctgtactctgccacatcttctccttcctcccaaccaaaaccaccat |
11299382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 351 - 454
Target Start/End: Complemental strand, 35190036 - 35189933
Alignment:
| Q |
351 |
ataagcaccttaccagactctatactctgccacatcctttcattcctctcaaccaaaacctccatatcaacaatctctctcgtttctcgccgctggcgcc |
450 |
Q |
| |
|
|||| |||| |||||||||| | |||||||| || || || |||||| ||||||||| | || | |||||||| ||||||| |||||||| ||||||| |
|
|
| T |
35190036 |
ataaacaccctaccagactcactcctctgccatatactctccttcctcccaaccaaaatcaccgtcacaacaatccctctcgtctctcgccgttggcgcc |
35189937 |
T |
|
| Q |
451 |
atct |
454 |
Q |
| |
|
|||| |
|
|
| T |
35189936 |
atct |
35189933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University