View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15926_high_11 (Length: 367)
Name: NF15926_high_11
Description: NF15926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15926_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 16 - 354
Target Start/End: Complemental strand, 28527143 - 28526805
Alignment:
| Q |
16 |
atgcgaaagggttagcaggagctgagttatttaaggcaaggtcagaaattggaagttttctattgttcaatgtgtaagctgttgtcataagagatgattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28527143 |
atgcgaaagggttagcaggagctgagttatttaaggcaaggtcagaaattggaagttttctattgttcaatgtgtaagctgttgtcataagagatgattt |
28527044 |
T |
|
| Q |
116 |
gatcattgcaggtgaccaatctttatgtactgatttaatcaacgcggctacgccgctaacatgaggacaagacattgaggtaccagaaacaatgttgaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28527043 |
gatcattgcaggtgaccaatctttatgtactgatttaatcaacgcggctacgccgctaacatgaggacaagacattgaggtaccagaaacaatgttgaat |
28526944 |
T |
|
| Q |
216 |
agtactcttcttttgtcactcttgatcatacttggactagtttttgatggccatgcagctaagatgttaacaccaggtgcagttacatttggtttgataa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28526943 |
agtactcttcttttgtcactcttgatcatacttggactagtttttgatggccatgcagctaagatgttaacaccaggtgcagttacatctggtttgataa |
28526844 |
T |
|
| Q |
316 |
tatcttgtgctattatgtttggtcctctagaagaaaatg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526843 |
tatcttgtgctattatgtttggtcctctagaagaaaatg |
28526805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University