View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15926_high_18 (Length: 285)
Name: NF15926_high_18
Description: NF15926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15926_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 81 - 223
Target Start/End: Complemental strand, 35303205 - 35303065
Alignment:
| Q |
81 |
gtggtcgaggttcgatcctcaaacctttgcatatattttatgcatcggccaactaagctaagctattcactctaattatacaacagaagcattttaaaat |
180 |
Q |
| |
|
|||| |||| ||||||||||||| |||||||||| ||||||||| || ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35303205 |
gtggccgagtttcgatcctcaaatctttgcatat--tttatgcattggacaactgagctaaactattcactctaattatacaacagaagcattttaaaat |
35303108 |
T |
|
| Q |
181 |
actggaactgaaaaacaaagcattgcattaaccaaccatgaat |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35303107 |
acttgaactgaaaaacaaagcattgcattaaccaaccatgaat |
35303065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University