View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15926_high_24 (Length: 236)
Name: NF15926_high_24
Description: NF15926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15926_high_24 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 47487109 - 47487323
Alignment:
| Q |
8 |
tttttatgacttcaccatagaattttccatgattgattatattatatttttgaccaagttgatgatgaatgattagattttcagaatt-----gcatgtc |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
47487109 |
tttttatgacttcaccatagaatttttcatgattgattatattatatttttgaccaagttgatgatgaatgattagaatttcagaattatattgcatgtc |
47487208 |
T |
|
| Q |
103 |
ttagtttccatttgaagccttaatatattatatacggatatgatatgattcgcacattcatttgttcacaaacaagacatcaatgactattcgttggcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47487209 |
ttagtttccatttgaagccttaatatattatatacggatatgatatgattcgcacattcatttgttcacaaacaagacatcaatgactattcgttggcaa |
47487308 |
T |
|
| Q |
203 |
ggcttatgggctatg |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47487309 |
ggcttatgggctatg |
47487323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 37109875 - 37109846
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcca |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37109875 |
atttttatgacttcaccatagaattttcca |
37109846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Original strand, 17842744 - 17842772
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17842744 |
atttttatgacttcaccatagaattttcc |
17842772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 36
Target Start/End: Complemental strand, 37203086 - 37203057
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcca |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37203086 |
atttttatgacttcaccatagaattttcca |
37203057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Original strand, 408726 - 408754
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
408726 |
atttttatgacttcaccatagaattttcc |
408754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Original strand, 17158180 - 17158208
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17158180 |
atttttatgacttcaccatagaattttcc |
17158208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 35
Target Start/End: Complemental strand, 18422675 - 18422647
Alignment:
| Q |
7 |
atttttatgacttcaccatagaattttcc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18422675 |
atttttatgacttcaccatagaattttcc |
18422647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 28769678 - 28769646
Alignment:
| Q |
6 |
tatttttatgacttcaccatagaattttccatg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
28769678 |
tatttttatgacttcaccatagaatttttcatg |
28769646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University