View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15926_low_32 (Length: 202)
Name: NF15926_low_32
Description: NF15926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15926_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 47 - 183
Target Start/End: Complemental strand, 25417600 - 25417464
Alignment:
| Q |
47 |
aatagatattatatttcatttggtgaataagtagaggtgaggtgtcatcaattgttagaagttatacaatgttaattgaggttacactagcttaggaccg |
146 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25417600 |
aatagatattatacttcatttggtgaataagtagaggtgaggtgtcatcaattgttggaagttatacaatgttaattgaggttacactagcttaggaccg |
25417501 |
T |
|
| Q |
147 |
gccctgacaacataatgtaaaatcttttaacgactct |
183 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25417500 |
gccctaacaacataatgtaaaatcttttaacgactct |
25417464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 47
Target Start/End: Complemental strand, 25417653 - 25417622
Alignment:
| Q |
16 |
tattctccattttataataaatgatgataata |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25417653 |
tattctccattttataataaatgatgataata |
25417622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 96 - 181
Target Start/End: Complemental strand, 1006750 - 1006665
Alignment:
| Q |
96 |
aattgttagaagttatacaatgttaattgaggttacactagcttaggaccggccctgacaacataatgtaaaatcttttaacgact |
181 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||| ||| || |||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
1006750 |
aattgttggaagttatgcaatgttaattgaggttacattagttttggaccggccctgacaacataatgtaaaatcattcaacgact |
1006665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 1006816 - 1006771
Alignment:
| Q |
64 |
atttggtgaataagtagaggtgaggtgtcatcaattgttagaagtt |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
1006816 |
atttggtgaataagtagaggtgatgtgtcatcaattgttggaagtt |
1006771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University