View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_high_29 (Length: 385)
Name: NF15927_high_29
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 4e-48; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 259 - 368
Target Start/End: Complemental strand, 11453495 - 11453386
Alignment:
| Q |
259 |
gttggctccaattcaagccctatgcatcaccattaatttaccgcaaattccaaaagcttaatttatctctctaatcttgcaccacaatttccctaatttc |
358 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11453495 |
gttggctccaattcaaaccctatgcatcaccattaatttaccgcaaattccaaaaccttaatttatctctctaatcttgcaccacaatttccctaacttc |
11453396 |
T |
|
| Q |
359 |
tctcacaatc |
368 |
Q |
| |
|
|||||||||| |
|
|
| T |
11453395 |
tctcacaatc |
11453386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 62 - 210
Target Start/End: Complemental strand, 11453819 - 11453682
Alignment:
| Q |
62 |
ttggaacctacatgaaataacgctgagatcatagtccatttaacacatgactatttaacatgttattagtttttatattagaattggcgttgcttt-ata |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||||| || ||||||| ||| |
|
|
| T |
11453819 |
ttggaacctacatgaaataacgttgagatcatagtccatttaacacatgt------------ttattagcttttatatgagaattagccttgcttttata |
11453732 |
T |
|
| Q |
161 |
attatcccattaatattaataatccattttatgaaagtgtctaccgatca |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
11453731 |
attatcccagtaatattaataatccattttatagaagtatctaccgatca |
11453682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 11454148 - 11454081
Alignment:
| Q |
1 |
atggtttgtg-gttgaatcaaattgcatgattaatggtaattttttnnnnnnntgccttaagttggaa |
67 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11454148 |
atggtttgtgtgttgaatcaaattgcatgattaatggtaattttttttaaaaatgccttaagttggaa |
11454081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 258
Target Start/End: Complemental strand, 11453603 - 11453547
Alignment:
| Q |
202 |
taccgatcaaagtggtcaactaaataccttattgatttgcaattttttacaaaattg |
258 |
Q |
| |
|
||||||||||||| ||||||| || ||||| | ||||||||| ||||||||||||| |
|
|
| T |
11453603 |
taccgatcaaagtcgtcaactcgatgccttaataatttgcaatattttacaaaattg |
11453547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University