View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_high_70 (Length: 226)
Name: NF15927_high_70
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_high_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 45211470 - 45211664
Alignment:
| Q |
13 |
gtgagaagaatctcatatttgatgaaataaaatttaaaaatgtgttaataaatgacagcggcccttgtaagaattgagttaagttaaacacaaattctaa |
112 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45211470 |
gtgataagaatctcatatttgatgagataaaatttaaaaatgtgttaataaatgagagcggcccttgtaaaaattgagttaagttaaacacaaattctaa |
45211569 |
T |
 |
| Q |
113 |
aaatccgagtaacgtaggtcaagaatattggagtacttcctcgtggctcataattgcccctacttttcccattaatatgttctggcatatatctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211570 |
aaatccgagtaacgtaggtcaagaatattggagtacttcctcgtggctcaaaattgcccctacttttcccattaatatgttctggcatatatctt |
45211664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University