View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_high_73 (Length: 220)
Name: NF15927_high_73
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_high_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 31494752 - 31494961
Alignment:
| Q |
1 |
cattttccaaaaactaatcctatgggatgcacaaactcaaacatcaaattgctttatggctaaactttccatcaaaatatcataattaggcaatgnnnnn |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31494752 |
cattttccaaaaacaaatcctatgggatgcacaaactcaaacatcaaattgctttatggctaaactttccatcaaaatatcataattaggcaatgttttt |
31494851 |
T |
 |
| Q |
101 |
nnnnnnngatcaacttcaccaagcaacctaaccatattcattccttctctttcagccctcatttggaaactcataaaaatactctcaagcctacttcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31494852 |
tctttttgatcaacttcaccaagcaacctaaccatattcattccttctctttcagccctcatttggaaactcataacaatactctcaagcctacttcttt |
31494951 |
T |
 |
| Q |
201 |
ccaacctatg |
210 |
Q |
| |
|
|||| ||||| |
|
|
| T |
31494952 |
ccaatctatg |
31494961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University