View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_42 (Length: 342)
Name: NF15927_low_42
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 5e-87; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 31494933 - 31495099
Alignment:
| Q |
1 |
ctctcaagcctacttctttccaatctatgattttcagctttatttttcaatttcaaaatctccaactttgaattcttaaataaaatcatcacttctgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31494933 |
ctctcaagcctacttctttccaatctatgattttcagctttatttttcaattccaaaatctccaactttgaattcttaaataaaatcatcacttctgtct |
31495032 |
T |
 |
| Q |
101 |
tttccaccaatctcctcctaattggaatcacattgtatcccattccctgcaaatcttccattgtctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31495033 |
tttccaccaatctcctcctaattggaatcacattgtatcccattccctgcaaatcttccattgtctt |
31495099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 184 - 336
Target Start/End: Original strand, 31495364 - 31495516
Alignment:
| Q |
184 |
atgttcttggagtttttcgtttgttttcaccatgacaggataatcaggaacaagggtaaaaacagtgtgaagagattgatattcagcagtatttttcaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31495364 |
atgttcttggagtttttcgtttgttttcaccatgacaggataatcaggaacaagggtaaaaacagtgtgaagagattgatattcggcagtatttttcaaa |
31495463 |
T |
 |
| Q |
284 |
tcaactagtttagcttgaacagttttttctacattgaaaatatcacatatatt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31495464 |
tcaactagtttagcttgaacagttttttctacattgaaaatatcacatatatt |
31495516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 31495313 - 31495352
Alignment:
| Q |
181 |
ggaatgttcttggagtttttcgtttgttttcaccatgaca |
220 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31495313 |
ggaattttcttggagttttttgtttgttttcaccatgaca |
31495352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University