View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_50 (Length: 306)
Name: NF15927_low_50
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 187 - 290
Target Start/End: Original strand, 671192 - 671296
Alignment:
| Q |
187 |
tccattcttctttagttatacatttatactcccattaaatgtaaccgaaaa-aatactctcacttatacatttatctctctttcaaattaacgtgagggg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| | ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
671192 |
tccattcttctttagttatacatttatacttccactcaatgtaacccaaaaaaatactctcacttatacatttatctctctttcaaattaatgtgagggg |
671291 |
T |
|
| Q |
286 |
ataag |
290 |
Q |
| |
|
||||| |
|
|
| T |
671292 |
ataag |
671296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 16 - 136
Target Start/End: Original strand, 669313 - 669430
Alignment:
| Q |
16 |
ggtctatatttttatagtatttcnnnnnnnggtacaatagttatattgtatttgtgtttttctaaagaagttttaagtgctaaacagtacaggacttgtg |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
669313 |
ggtctatatttttatagtattt---tttttggtacaatagttttattgtatttgtgtttttctagagaagttttaagtgctaaacagtacgggacttgtg |
669409 |
T |
|
| Q |
116 |
cgtacgaattttcacggatgc |
136 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
669410 |
cgtacgaattttcacgaatgc |
669430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University