View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_55 (Length: 291)
Name: NF15927_low_55
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 29786501 - 29786236
Alignment:
| Q |
13 |
aatataattgtttttctgcaacgtagccttggatttttgctttgagcctacttggacttgctcccctagctgaacgtgtcagcttcctcactgagtaagt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29786501 |
aatataattgtttttctgcaacgtagccttggatttttgctttgagcctacttggacttgctcccctagctgaacgtgtcagcttcctcactgagtaaga |
29786402 |
T |
 |
| Q |
113 |
ttgcatgttacattctaattttaattttacttactatagtaatatgattatttttcaaatttcatgtgtttctaacatttgctatctaatt-ttttgtta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29786401 |
ttgcatgttacattctaattttaattttactcactatagtaatatgattatttttcaaatttcatgtgtttctaacatttgctatctaatttttttgtta |
29786302 |
T |
 |
| Q |
212 |
ctcaaaattttcacctgaactgcttgaacttgaaggcaaattgcatatttcaccggcccaacaggt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29786301 |
ctcaaaattttcacctgaactgcttgaacttgaaggcaaattgcatatttcaccggcccaacaggt |
29786236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University