View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_57 (Length: 283)
Name: NF15927_low_57
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 30692917 - 30692755
Alignment:
| Q |
18 |
attttgtatgtttagaaaatgtactgctgnnnnnnntaacaagagtgataatttcactttccaggtgataatctatgggatttgtatcaatgacactgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30692917 |
attttgtatgtttagaaaatgtactgctgaaaaaaataacaagagtgataatttcactttccaggtgataatctatgggatttgtatcaatgacactgaa |
30692818 |
T |
 |
| Q |
118 |
gcattatgtttttaaaagtgttttatctaaaaattaactgacatcaaaggttggaatttattg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30692817 |
gcattatgtttttaaaagtgttttatctaaaaattaactgatatcaaaggttggaatttattg |
30692755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 193 - 271
Target Start/End: Complemental strand, 30692726 - 30692648
Alignment:
| Q |
193 |
ggcttcaagagtgattttgcaaaagaaaaggaaccttttgtttaatcacttcattagtcaacatactcgtgttatcctt |
271 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30692726 |
ggcttcaagagtgattttgcgaaagaaaaggaaccttttgtttaatcacttcattagtcaacatactagtgttatcctt |
30692648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University