View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_71 (Length: 239)
Name: NF15927_low_71
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 25047662 - 25047454
Alignment:
| Q |
18 |
caataatcattcttgcgtcagcccagacaatattattaatcttttcctcaaaatttaattgtatagtatattgaaaagagtgattatcatgtaatcggcg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047662 |
caatcatcattcttgcgtcagcccagacaatattattaatcttttcctcaaaatttaattgtatagtatattgaaaagagtgattatcatgtaatcggcg |
25047563 |
T |
|
| Q |
118 |
taaaaagtacttttgtatacgtccagcttctccataaactaacgtttgcttcgaagatagctcttttggtcttgtttgatgtatccaatgtcattttccc |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047562 |
taaaaagtacttttgtatacttccagcttctccataaactaacgtttgcttcaaagatagctcttttggtcttgtttgatgtatccaatgtcattttccc |
25047463 |
T |
|
| Q |
218 |
cacaggttc |
226 |
Q |
| |
|
|||| |||| |
|
|
| T |
25047462 |
cacatgttc |
25047454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University