View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_76 (Length: 232)
Name: NF15927_low_76
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 36273644 - 36273848
Alignment:
| Q |
14 |
aaatgaaaaagttgaactttttaaagaagggg-accaaatcaatatgtgggacatgaactttatcaacaatgcaaggtgaagcgaggtagaaaatgttat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273644 |
aaatgaaaaagttgaactttttaaagaagggggaccaaatcaatatgtgggacatgaactttatcaacaatgcaaggtgaagcgaggtagaaaatgttat |
36273743 |
T |
 |
| Q |
113 |
tgcaacatcggagaatggtgatgattgtgtcgtagttgaggtggttgatttggaagaagcaaatatttgtttgtccattgagatttttagatctgtcata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
36273744 |
tgcaacatcggagaatggtgatgattgtgtcgtagttgcggtggttgatttggaagaagcaaatatttgtttgtccattgagatttttagatgtgttata |
36273843 |
T |
 |
| Q |
213 |
gttag |
217 |
Q |
| |
|
||||| |
|
|
| T |
36273844 |
gttag |
36273848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University