View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15927_low_77 (Length: 230)
Name: NF15927_low_77
Description: NF15927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15927_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 44244656 - 44244842
Alignment:
| Q |
1 |
acgctttgttgaactggcatagatgagatcgccatcttgtgaggacaaataatactttgaacttctacataggagcaatatcagttgttaaagcttcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44244656 |
acgctttgttgaactggcatagatgagatcgccatcttgtgaggacaaataatactttgaacttctacataggagcaatatcagttgttaaagcttcaaa |
44244755 |
T |
|
| Q |
101 |
cattagttcaacttggattatgagacacttttcttcgattgatttcatgatgtttatataacaagatgttcccagatcttgttataa |
187 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44244756 |
cattagttcaacttggattatgaaacacttttcttcgattgatttcatgatgtttatataacaagatgttcccagatcttgttataa |
44244842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University