View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15928_low_13 (Length: 238)
Name: NF15928_low_13
Description: NF15928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15928_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 35123553 - 35123771
Alignment:
| Q |
1 |
tttctataatgaaaaattaccatgaaggaatggtgttgtagttcaagaaaatcttagctcaaattatcagtcacnnnnnnntaataatcatattacattc |
100 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35123553 |
tttctataataaaaatttaccatgaagggatggtgttgcagttcaagaaaatcttagctcaaattatcagtcacaaaaaaataataatcatattacattc |
35123652 |
T |
 |
| Q |
101 |
ttttattaccaacatattgcattcttttaagactacaaattatttaaannnnnnnnngagggaaaattatttaaattttaatatcaacattattgttgta |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35123653 |
ttttattaccaacagattgcattcttttaagactataaattatttgaatttttttttgagggaaaattatttaaattttaatatcaacattattgttata |
35123752 |
T |
 |
| Q |
201 |
atatttaagagaagtgtta |
219 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
35123753 |
atatttaagggaagtgtta |
35123771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University