View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15928_low_9 (Length: 330)
Name: NF15928_low_9
Description: NF15928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15928_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 35120730 - 35121073
Alignment:
| Q |
1 |
tgagttttgggttagtttgagttccagaggcagtggttggtggggtatatcctccacgtaggatttaagtgggtccaa-atgtgaagattagggtgtgcc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35120730 |
tgagttttgggttagtttgagttccagaggcagtggttggtggggtcgattttccacgtaggatttaagtgggtccaatatgtgaagattagggtgtgcc |
35120829 |
T |
|
| Q |
100 |
acattggaagctatgctagggccgactttgtttatctgagttggttgaaaacgacagcgttgtgtaaggacggtgatactgattgatggggcccactcga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35120830 |
acattggaagctatgctagggccgactttgtttatctgagttggttgaaaacgacagcgttgtgtaaggacggtgatactgattgatggggcccactcga |
35120929 |
T |
|
| Q |
200 |
gggacctaccctgagaaattttttacaggcatc---------------tatttcttttgcagatagtaaagactaatttgatgtcacttgattttttcgt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35120930 |
tggacctaccctgagaaattttttacaggcatctatttcttttgcagatatttcttttgcagatagtaaagactaatttgatgtcacttgattttttcgt |
35121029 |
T |
|
| Q |
285 |
ggatcaaattaattcatactattataaggagttggaaattagtc |
328 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
35121030 |
ggatcaaattaattcatactattacaaggagttgcaaattagtc |
35121073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University