View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15929_high_11 (Length: 349)
Name: NF15929_high_11
Description: NF15929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15929_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 38 - 349
Target Start/End: Original strand, 34899398 - 34899709
Alignment:
| Q |
38 |
cccttttgttttgacacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899398 |
cccttttgttttgacacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
34899497 |
T |
 |
| Q |
138 |
aatttttgacttcttcaacnnnnnnnntctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattga-tatcgaaa |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34899498 |
aatttttgacttcttcaacaaaaaaaatctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaa |
34899597 |
T |
 |
| Q |
237 |
atgtgtctctaaaaatgttcttagttattaggagaacctcaattagtgggtcagttgacatgttccacttggtttttatgcgtaacgtaccacacaagca |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34899598 |
atgtgtctctaaaaatgttcttagttattaggagaacctcaactagtgggtcagttgacatgttccacttggtttttatgcgtaa-gtaccacacaagca |
34899696 |
T |
 |
| Q |
337 |
tatgcaaatgtta |
349 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34899697 |
tatgcaaatgtta |
34899709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University