View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15929_high_13 (Length: 336)
Name: NF15929_high_13
Description: NF15929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15929_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 23 - 319
Target Start/End: Complemental strand, 7215125 - 7214821
Alignment:
| Q |
23 |
atgtcaagttgtacaagtacaacgcttttaagacctttcacaacactaaacaaaaggttagttcacattttttcaaacatatggttgtttatttggnnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7215125 |
atgtcaagttgtacaagtacaacgcttttaagacctttcacaacactaaacaaaaggttagttcacattttttcaaacatatggttgtttatttggtttt |
7215026 |
T |
 |
| Q |
123 |
nnnnngtgcaggttatttttt-agcgataattattctaacacaca-------catgttacactctttaaggaaatacattgagtttcgaagaaaattgac |
214 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7215025 |
tttttgtgcaggttatttttttagcgatcattattctaacacacaacacacacatgttatactctttaaggaaatacgttgagtttcgaagaaaattgac |
7214926 |
T |
 |
| Q |
215 |
gatttgaagacaaacactcatccgattacacatgaaatgccaaagtttaaagatttgaacggcggattccgaagttgggttttggatttatgagtctcta |
314 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7214925 |
gatttgaagacaaacactcatccggttatacatgaaatgccaaagtttaaagatttgaacggcggattccgaagttgggttttggatttatgagtctcta |
7214826 |
T |
 |
| Q |
315 |
atttg |
319 |
Q |
| |
|
||||| |
|
|
| T |
7214825 |
atttg |
7214821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University