View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1592_high_13 (Length: 234)
Name: NF1592_high_13
Description: NF1592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1592_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 26262737 - 26262518
Alignment:
| Q |
1 |
ccaagttctggatattcatggatttctcttcttatttgcttcatccatttcactgtgttggggttgttagcaacctcaagaatctgatttttcagtgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26262737 |
ccaagttctggatattcatggatttctcttcttatttgcttcatccatttcactgtgttggggttgttagcaacctcaagaatctgatttttcagtgatg |
26262638 |
T |
 |
| Q |
101 |
aagtttggtttgaacattcatttgcttcaaaattgatagataagcacatgaagatgagcaagagagcaagtcttatatgattgtttaggtccatcattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26262637 |
aagtttggtttgaacattcatttgcttcaaaattgatagataagcacatgaagatgagcaagagagcaagtcttatatgattgtttaggtccatcattca |
26262538 |
T |
 |
| Q |
201 |
tgtggtaaagtggtagatag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26262537 |
tgtggtaaagtggtagatag |
26262518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 2 - 124
Target Start/End: Original strand, 31839610 - 31839732
Alignment:
| Q |
2 |
caagttctggatattcatggatttctcttcttatttgcttcatccatttcactgtgttggggttgttagcaacctcaagaatctgatttttcagtgatga |
101 |
Q |
| |
|
||||||| || || ||||| ||||||||||| || | |||||||||||||||||||||||| ||||||||| ||||||||| | | |||||||||| || |
|
|
| T |
31839610 |
caagttcagggtactcatgaatttctcttctgatgttcttcatccatttcactgtgttgggtgtgttagcaagctcaagaatttcacttttcagtgaaga |
31839709 |
T |
 |
| Q |
102 |
agtttggtttgaacattcatttg |
124 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
31839710 |
agtttggtttgaacattcctttg |
31839732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University