View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1592_high_5 (Length: 317)
Name: NF1592_high_5
Description: NF1592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1592_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 301
Target Start/End: Complemental strand, 42125875 - 42125582
Alignment:
| Q |
11 |
cacagatatcataaggtgttaacacctttcatactcataatcgtctctcgaactaaaaaa-catagtaatttctggaattatcccaaattcaggttcttg |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125875 |
cacagatattataaggtgttaacacctttcatactcataatcgtctctcgacctaaaaaaacatagtaatttctggaattatcccaaattcaggttcttg |
42125776 |
T |
 |
| Q |
110 |
aaatattttaatttgatttcaaattaatttttatcatcgttnnnnnnnn--tcacctttgaatattttcttggatagaaactggattggatatttattac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125775 |
aaatattttaatttgatttcaaattaatttttatcatcgttaaaaaaaaaatcacctttgaatattttcttggatagaaactggattggatatttattac |
42125676 |
T |
 |
| Q |
208 |
tcgtttattattatcatcaattatttcgttgaaatcatgtatattgatagatcaacaaatcgattaattggtaacaactttatgaagtataatc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125675 |
tcgtttattattatcatcaattatttcgttgaaatcatgtatattgatagatcaacaaatcgattaattggtaacaactttatgaagtataatc |
42125582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University