View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1592_low_11 (Length: 248)
Name: NF1592_low_11
Description: NF1592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1592_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 35425351 - 35425230
Alignment:
| Q |
107 |
gctaatacgtttagcaaacaatatctagttttttgtcatcaatatttcgttttaaataatagaaaatggttgtattnnnnnnnnctaaattagtgttaat |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35425351 |
gctaatacttttagcaaacaatatctagttttttgtcatcaatatttcgttttaaataatagaaaatggttgtatt-aaaaaaactaaattagtgttaat |
35425253 |
T |
 |
| Q |
207 |
ttaaagaccaaatgtgttgaaac |
229 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
35425252 |
ttaaaggccaaatgtgttgaaac |
35425230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University