View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15930_high_21 (Length: 301)
Name: NF15930_high_21
Description: NF15930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15930_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 29 - 94
Target Start/End: Original strand, 27209699 - 27209764
Alignment:
| Q |
29 |
gatgttcactctattctctcttctccagatagagactttcttcttcgcaacacaggcgatcaggta |
94 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27209699 |
gatgttcactctctcctctcttctccagatagagactttcttcttcgcaacaccggcgatcaggta |
27209764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 98
Target Start/End: Original strand, 27194333 - 27194399
Alignment:
| Q |
32 |
gttcactctattctctcttctccagatagagactttcttcttcgcaacacaggcgatcaggtacttc |
98 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
27194333 |
gttcactctattctctcttcttccgatagagactttcttcttcgaaacaccggcgatcaggtacttc |
27194399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 136 - 231
Target Start/End: Original strand, 27194450 - 27194544
Alignment:
| Q |
136 |
atgaaattgttaagagattaatgtcatcaaatgttttttaatttcgtgaatcataatttttagtaatttcttgaatcatacaaaactctaccattt |
231 |
Q |
| |
|
|||||||| ||| |||| |||||| ||||||| ||||||||||| ||| |||||| |||||||| |||||||| ||| ||||| |||||| |||| |
|
|
| T |
27194450 |
atgaaattattatgagactaatgtgatcaaatattttttaatttgatgagtcataa-ttttagtactttcttgattcaaacaaacctctacaattt |
27194544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University