View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15930_low_29 (Length: 249)
Name: NF15930_low_29
Description: NF15930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15930_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 232
Target Start/End: Complemental strand, 42695568 - 42695348
Alignment:
| Q |
12 |
agcagagacaacatgtgatgaaacttggtgctattataaatttttcacatatgaaagcgctaaaccaaagccaatgcttccaccgattcagatacacggc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42695568 |
agcagagacaacatgtgatgaaacttggtgctattataaatttctcacatatgaaagcgctaaaccaaagccaaagcttccaccgattcagatacacggc |
42695469 |
T |
 |
| Q |
112 |
tttccgcagaggaaaacaaaccggagttctatttttgaagttgtccatttgagagtcgggccaatctcacgcgtcaaaaatcaaatgtttcactctcaac |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695468 |
tttccgcagagaaaaacaaaccggagttctatttttgaagttgtccatttgagagtcggaccaatctcacgcgtcaaaaatcaaatgtttcactctcaac |
42695369 |
T |
 |
| Q |
212 |
tcaaagattagtctcataaca |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42695368 |
tcaaagattagtctcataaca |
42695348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University