View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15930_low_32 (Length: 220)
Name: NF15930_low_32
Description: NF15930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15930_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 39097588 - 39097774
Alignment:
| Q |
20 |
cgtttcaccttcaattgcagcttgcttctacgggtaactctctcttttcttcccttacaaatccaactaaacattataatgtannnnnnnnnattta-aa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| ||| || |
|
|
| T |
39097588 |
cgtttcaccttcaattgcagcttgcttctacgggtaactctctctttacttcccttacaaatgcaactaaacattatcatgtatttttttttttttttaa |
39097687 |
T |
 |
| Q |
119 |
atttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcttatgattcaagctttaagcctttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39097688 |
atttattgattcaagttcctttactgcgtgctatttaggttttcacttttccttgttttgtcttatgattcaagctttaagcctttg |
39097774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University