View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15930_low_35 (Length: 210)
Name: NF15930_low_35
Description: NF15930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15930_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 26882099 - 26881915
Alignment:
| Q |
12 |
gataagaaggttggagatgtgttacaactgtctattgtccgagcatctcaatatgaccccatacatgtcaatatggtggttgatgaagttgcggtcaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
26882099 |
gataagaaggttggagatgtgttacaactgtctattgtccgagcatctcaatatgaccccatacatgtcaatatggtggttgatgaagttgctgtcgaat |
26882000 |
T |
 |
| Q |
112 |
atttttatcagtaagtcttgtgtcaatacgatcttgtatcttgactagtttcatataatatctcctattggtacttatggttttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881999 |
atttttatcagtaagtcttgtgtcaatacgatcttgtatcttgactagtttcatataatatctcctattggtacttatggttttt |
26881915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 26634614 - 26634804
Alignment:
| Q |
12 |
gataagaaggttggagatgtgttacaactgtctattgtccgagcatctcaat------atgaccccatacatgtcaatatggtggttgatgaagttgcgg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||||||||||| |||| ||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
26634614 |
gataagaaggttggagatgtgttacaactgtctgtggcccgagcatctcaaagtcaaaatgatcccgtacatgtcaatatggtggttgatgaagttgctg |
26634713 |
T |
 |
| Q |
106 |
tcaaatatttttatcagtaagtcttgtgtcaatacgatcttgtatcttgactagtttcatataatatctcctattggtacttatggttttt |
196 |
Q |
| |
|
|| || ||||| ||| |||||||| ||||| ||| || || |||||||| |||||||| ||||||| ||||||||| || |||| ||||| |
|
|
| T |
26634714 |
tcgaaaattttaatcggtaagtctcatgtcattacaatattatatcttgattagtttcaaataatatttcctattggaacatatgattttt |
26634804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University